1403787-62-1

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)^[1].

Bepirovirsen (16-250 nM; 16 h) reduces hepatitis B virus (HBV) RNA, DNA, and viral proteins in HepG2.2.15 cells^[1].

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

Bepirovirsen Related Antibodies

• HBsAg Antibody (YA913)

Bepirovirsen (22-50 mg/kg/week; s.c. twice weekly for week 1 and once weekly for weeks 2-4) reduces hepatic HBV RNA and DNA in HBV-transgenic mice^[1].

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

7344.00

1403787-62-1

Solid

White to off-white

DNA, d(P-thio)([2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]rA-G-G-T-G-A-A-G-m5C-G-A-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rU-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC)

[Bepirovirsen]

Room temperature in continental US; may vary elsewhere.

-20°C, sealed storage, away from moisture

*In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

In Vitro: 

H₂O : ≥ 20 mg/mL (2.72 mM)

*"≥" means soluble, but saturation unknown.

Preparing
Stock Solutions

 View the Complete Stock Solution Preparation Table

* Please refer to the solubility information to select the appropriate solvent. Once prepared, please aliquot and store the solution to prevent product inactivation from repeated freeze-thaw cycles.
Storage method and period of stock solution: -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture). When stored at -80°C, please use it within 6 months. When stored at -20°C, please use it within 1 month.

* Note: If you choose water as the stock solution, please dilute it to the working solution, then filter and sterilize it with a 0.22 μm filter before use.

• Molarity Calculator

• Dilution Calculator

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

In Vivo Dissolution Calculator

Please enter the basic information of animal experiments:

Dosage

Animal weight
(per animal)

Dosing volume
(per animal)

Number of animals

Recommended: Prepare an additional quantity of animals to account for potential losses during experiments.

Purity: 98.44%

COA (247 KB)LCMS (315 KB)

• [1]. Yuen MF, et al. Safety, tolerability and antiviral activity of the antisense oligonucleotide bepirovirsen in patients with chronic hepatitis B: a phase 2 randomized controlled trial. Nat Med. 2021 Oct;27(10):1725-1734.  [Content Brief]

  [2]. Han K, et, al. Preclinical and Phase 1 Assessment of Antisense Oligonucleotide Bepirovirsen in Hepatitis B Virus-Transgenic Mice and Healthy Human Volunteers: Support for Clinical Dose Selection and Evaluation of Safety, Tolerability, and Pharmacokinetics of Single and Multiple Doses. Clin Pharmacol Drug Dev. 2022 Oct;11(10):1191-1202.  [Content Brief]