
2563929-84-8
- Product Name:Bepirovirsen Sodium
- Molecular Formula:C230H290N88Na19O115P19S19
- Purity:99%
- Molecular Weight:7762.00
Product Details:
CasNo: 2563929-84-8
Molecular Formula: C230H290N88Na19O115P19S19
Appearance: White to off-white Solid
Delivery Time: 2 weeks after order
Packing: Bottle
Throughput: 1KG/Month
Purity: 99%
Description |
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC)[1][2][3]. |
||||||||
---|---|---|---|---|---|---|---|---|---|
In Vitro |
Bepirovirsen sodium (16-250 nM, 96 h) reduces levels of HBV RNA transcripts in HBV-expressing HepG cells[3]. MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only. Bepirovirsen sodium Related Antibodies |
||||||||
In Vivo |
Bepirovirsen sodium (22 and 50 mg/kg, s.c., twice weekly for week 1 and once weekly for weeks 2-4) reduces hepatic RNA transcripts, subsequent production of HBV DNA, and associated HBV serum antigens in HBV-transgenic mice[3]. MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.
|
||||||||
Molecular Weight |
7762.00 |
||||||||
Formula |
C230H290N88Na19O115P19S19 |
||||||||
CAS No. | |||||||||
Appearance |
Solid |
||||||||
Color |
White to off-white |
||||||||
SMILES |
[Bepirovirsen (sodium)] |
||||||||
Shipping |
Room temperature in continental US; may vary elsewhere. |
||||||||
Storage |
-20°C, sealed storage, away from moisture *In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture) |
||||||||
Purity & Documentation |
Purity: 98.44% Data Sheet (268 KB)SDS (252 KB) Handling Instructions (2659 KB) |
||||||||
References |
|
Bepirovirsen sodium Related Classifications
-
Molarity Calculator
-
Dilution Calculator
The molarity calculator equation
Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)
Relevant Products
-
Citicoline Sodium
CAS:33818-15-4
-
Bepirovirsen
CAS:1403787-62-1
-
SINENSETIN
CAS:2306-27-6